Journal: PeerJ

Article Title: Hepatic nuclear factor 4 alpha promotes the ferroptosis of lung adenocarcinoma via transcriptional activation of cytochrome P450 oxidoreductase.

doi: 10.7717/peerj.15377

Figure Lengend Snippet: Figure 1 HNF4A expression significantly decreased in ferroptotic A549 cells. (A) The HNF4A expression in A549 cells treated with RSL3 and IKE. (B) qRT-PCR and Western blot (C) results of HNF4A expression in A549 cells after the treatment of RSL3 and IKE, with or without DFO. ns, not significant; p < 0.05, p < 0.01, p < 0.001. Full-size

Article Snippet: GENECHEM (Shanghai, China) provided the negative control virus, sh-HNF4A-1 (5′- GCTTCTCTCCAAGGCTAAACT -3′), sh-HNF4A-2 (5′- GGACTAGCAAACTCTACAAAT-3′), and HNF4A overexpression viruses. (1S,3R)- Besskaya et al. (2023), PeerJ, DOI 10.7717/peerj.15377 2/12 RSL3 was purchased from MedChemExpress (NJ, USA), while imidazole ketone erastin (IKE) and deferoxamine (DFO) were both purchased from TOPSCIENCE (Shanghai, China).

Techniques: Expressing, Quantitative RT-PCR, Western Blot

Journal: PeerJ

Article Title: Hepatic nuclear factor 4 alpha promotes the ferroptosis of lung adenocarcinoma via transcriptional activation of cytochrome P450 oxidoreductase.

doi: 10.7717/peerj.15377

Figure Lengend Snippet: Figure 2 HNF4A promoters ferroptosis and POR’s expression in lung adenocarcinoma. (A) The expression of HNF4A in different lung ade- nocarcinoma cell lines. (B) qRT-PCR and (C) Western blot results of HNF4A and POR expression in HNF4A knocked down A549 and HNF4A overexpressed H23 cells. (D) Cytotoxicity of RSL3 and IKE, and (E) the level of cellular lipid peroxidation in cells with knocked down or over- expressed HNF4A. p < 0.05, p < 0.01, p < 0.001. Full-size

Article Snippet: GENECHEM (Shanghai, China) provided the negative control virus, sh-HNF4A-1 (5′- GCTTCTCTCCAAGGCTAAACT -3′), sh-HNF4A-2 (5′- GGACTAGCAAACTCTACAAAT-3′), and HNF4A overexpression viruses. (1S,3R)- Besskaya et al. (2023), PeerJ, DOI 10.7717/peerj.15377 2/12 RSL3 was purchased from MedChemExpress (NJ, USA), while imidazole ketone erastin (IKE) and deferoxamine (DFO) were both purchased from TOPSCIENCE (Shanghai, China).

Techniques: Expressing, Quantitative RT-PCR, Western Blot

Journal: PeerJ

Article Title: Hepatic nuclear factor 4 alpha promotes the ferroptosis of lung adenocarcinoma via transcriptional activation of cytochrome P450 oxidoreductase.

doi: 10.7717/peerj.15377

Figure Lengend Snippet: Figure 3 HNF4A promoted POR expression via binding to POR’s promoter. (A) HNF4A binding peaks in POR’s promoter according to the ChIP-seq data in the Encode database. (B) The locations of HNF4A’s potential binding sites and primers in POR’s promoter. (C) The ChIP-qPCR results. (D) the sequences of HNF4A’s binding sites and corresponding mutated sequences in the luciferase assays. (E) The results of dual-luciferase assays. ns, not significant; p < 0.01, p < 0.001. Full-size

Article Snippet: GENECHEM (Shanghai, China) provided the negative control virus, sh-HNF4A-1 (5′- GCTTCTCTCCAAGGCTAAACT -3′), sh-HNF4A-2 (5′- GGACTAGCAAACTCTACAAAT-3′), and HNF4A overexpression viruses. (1S,3R)- Besskaya et al. (2023), PeerJ, DOI 10.7717/peerj.15377 2/12 RSL3 was purchased from MedChemExpress (NJ, USA), while imidazole ketone erastin (IKE) and deferoxamine (DFO) were both purchased from TOPSCIENCE (Shanghai, China).

Techniques: Expressing, Binding Assay, ChIP-sequencing, ChIP-qPCR, Luciferase

Journal: PeerJ

Article Title: Hepatic nuclear factor 4 alpha promotes the ferroptosis of lung adenocarcinoma via transcriptional activation of cytochrome P450 oxidoreductase.

doi: 10.7717/peerj.15377

Figure Lengend Snippet: Figure 4 POR restoration blocked HNF4A’s promotion on ferroptosis in lung adenocarcinoma. (A) qRT-PCR and (B) western blot results of POR restoration in cells with knocked down or overexpressed HNF4A. (C) The cytotoxicity of ferroptosis inducers and (D) the level of cellular lipid peroxidation in HNF4A-altered cells after POR was restored. ns, not significant; p < 0.05, p < 0.01, p < 0.001.

Article Snippet: GENECHEM (Shanghai, China) provided the negative control virus, sh-HNF4A-1 (5′- GCTTCTCTCCAAGGCTAAACT -3′), sh-HNF4A-2 (5′- GGACTAGCAAACTCTACAAAT-3′), and HNF4A overexpression viruses. (1S,3R)- Besskaya et al. (2023), PeerJ, DOI 10.7717/peerj.15377 2/12 RSL3 was purchased from MedChemExpress (NJ, USA), while imidazole ketone erastin (IKE) and deferoxamine (DFO) were both purchased from TOPSCIENCE (Shanghai, China).

Techniques: Quantitative RT-PCR, Western Blot